rs72817866 chr6:8006291 C>T
- Sequence
acagcattcctaaccatcatggaa[C/T]tcataggcttttcctacattttgg
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.19 | -2.40 | 2.33 | |||
| A549 (lung carcinoma) | 0.67 | 0.28 | 1.12 | |||
| neural cell | -0.30 | 0.54 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood