rs728189 chr12:12008607 C>A
- Sequence
tgttgccagtgcacagggaacaat[C/A]ctcagtgtctgttacacaaatgag
- ASB in cell types
- MCF10A (breast epithelial cells) KMS-11 SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | n/a | 2.07 | 1.33 | |||
| KMS-11 | 2.05 | -1.81 | 1.50 | |||
| SK-N-SH (neuroblastoma) | 1.30 | 0.72 | 1.33 |
Items per page:
1 – 3 of 3