rs728449 chr1:34592398 G>C
- Sequence
cctgtgtcagtgattctgcactct[G/C]ttttagcctctctacttaggacgg
- ASB in cell types
- foreskin keratinocyte MCF10CA1a (breast metastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.87 | 2.00 | |||
| MCF10CA1a (breast metastatic epithelial cells) | 1.70 | n/a | 1.33 |
Items per page:
1 – 2 of 2