rs7289139 chr22:33923952 T>G
- Sequence
tgcctgatattaggaactggggaa[T/G]ctaaaggcacgttaagaacacagt
- ASB in cell types
- HEK293 (embryonic kidney) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.16 | 0.59 | 1.99 | |||
| PC9 (lung adenocarcinoma) | -0.89 | 1.77 | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting blood glucose, fasting insulin, homa-b, mitral annular calcium, systolic blood pressure (sbp), total cholesterol, triglycerides