rs7292074 chr22:38870446 C>A
- Sequence
actgagaggctgtcacacagccca[C/A]cagccttccagctgctccgcccat
- ASB in cell types
- pancreas Peyer's patch erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | -0.05 | 0.42 | 1.08 | |||
| Peyer's patch | 0.38 | 0.91 | 1.22 | |||
| erythroid cells | 2.00 | n/a | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, height, infant head circumference, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Cerebellum, Brain_Hypothalamus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood