rs729396 chr3:53194326 C>T
- Sequence
aaagcggagccttgtaactcgagc[C/T]gtttcctcccgtgtggaaccgggg
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.67 | 0.32 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diastolic blood pressure (dbp), infant head circumference, primary rhegmatogenous retinal detachment, serum creatinine, stabilized warfarin dose
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood