rs729737 chr17:57783639 G>A
- Sequence
cagttctctagggcgtcctggtta[G/A]gtcaacgggggctggttgggaacc
- ASB in cell types
- HEK293 (embryonic kidney) MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.50 | 0.54 | 1.70 | |||
| MM1.S (plasma cell myeloma) | -0.55 | 0.88 | 1.37 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, age at death with kuru exposure, hdl cholesterol, hypertension (early onset hypertension), infant head circumference, irritible bowel syndrome, rheumatoid arthritis