rs7298579 chr12:24596940 T>C
- Sequence
caaggtcactgtgaatttaaatca[T/C]gtctggataattccatggtgtttt
- ASB in cell types
- heart left ventricle hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| heart left ventricle | -1.49 | 1.72 | 1.00 | |||
| hepatocytes | 0.86 | -0.43 | 1.00 |
Items per page:
1 – 2 of 2