rs729949 chr7:116554851 G>A
- Sequence
catatctatctgggtgaaaactaa[G/A]caaataagacaattgtaaaggctt
- ASB in cell types
- HEK293 (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.23 | 0.71 | 1.90 | |||
| A549 (lung carcinoma) | 1.02 | -0.23 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), hdl cholesterol, primary open-angle glaucoma, primary rhegmatogenous retinal detachment, transmission distortion, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Testis, Thyroid