rs73018457 chr11:117817718 C>T
- Sequence
agaccccacagccaagaattaccc[C/T]agagtggggcaagtgctgtacctg
- ASB in cell types
- heart left ventricle foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| heart left ventricle | -2.04 | 2.10 | 1.00 | |||
| foreskin keratinocyte | 1.05 | -1.80 | 2.17 |
Items per page:
1 – 2 of 2