rs7304349 chr12:5022580 C>A
- Sequence
ggggctgaacccagcccaggtggg[C/A]caagccgtggcaccagccggactg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.95 | 0.32 | 1.80 | |||
| HEK293 (embryonic kidney) | 0.73 | -0.13 | 2.03 |
Items per page:
1 – 2 of 2