rs7307108 chr12:63826357 C>G
- Sequence
gttgtctcgcacactgcagcttta[C/G]agccattgagcagaacacccagcc
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.87 | 0.84 | 1.27 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, birth weight, fasting insulin, hdl cholesterol, homa-ir, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), obesity with early age of onset (age >2), triglycerides
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Colon_Sigmoid, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid