rs7311377 chr12:64010154 G>T
- Sequence
ctgccatcatctgaaaccctctca[G/T]taaatatttaatctggtttttctc
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA2_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | 2.53 | n/a | 1.33 | -4.15 | Concordant | |||
| FOXA1_HUMAN | 1.98 | -1.69 | 1.50 | -3.99 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP amyotrophic lateral sclerosis (als) age of onset, diastolic blood pressure (dbp), eye color, hypertension (early onset hypertension), parkinsons disease, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)