rs73128691 chr7:38178081 A>G
- Sequence
tttcccacccattcctacaggcag[A/G]ccggctcgccctctccctccttcc
- ASB in cell types
- A549 (lung carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.89 | -0.26 | 2.16 | |||
| HEK293 (embryonic kidney) | 0.47 | 0.55 | 1.46 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Lung, Testis, Thyroid