rs73169668 chr7:151233277 C>T
- Sequence
atcggccatggcgctcctgagagg[C/T]tgtcagtgctgagtcaccgatcta
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MNT_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 1.50 | -0.42 | 1.50 | n/a | n/a | |||
| HDAC1_HUMAN | 1.52 | 0.04 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis