rs7319385 chr13:97855701 T>G
- Sequence
tatatttggcactagggggcgata[T/G]agcattgctttcagcccttcactg
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte erythroid cells VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.35 | 0.91 | 2.23 | |||
| foreskin keratinocyte | 0.32 | n/a | 2.50 | |||
| erythroid cells | -3.17 | 2.26 | 2.00 | |||
| VCaP (prostate carcinoma) | -0.97 | 1.27 | 2.33 | |||
| epidermal keratinocytes | 1.79 | n/a | 2.00 |
Items per page:
1 – 5 of 5