rs73196798 chr3:188780597 C>A
- Sequence
cagctggacatgctccccaggttt[C/A]tactcagtctggaatgttagtaaa
- ASB in cell types
- periferal blood macrophages monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 1.21 | -0.14 | 2.00 | |||
| monocyte-derived dendritic cells | -1.71 | 1.92 | 2.00 |
Items per page:
1 – 2 of 2