rs73202803 chr4:1748857 G>A
- Sequence
agggggcgccattgggccaccgga[G/A]ccccttctgcagacccggcgcgac
- ASB in cell types
- foreskin keratinocyte H1 (embryonic stem cells) MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.31 | n/a | 2.50 | |||
| H1 (embryonic stem cells) | 1.16 | 0.62 | 1.42 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | -1.49 | 1.72 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Amygdala, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood