rs7320514 chr13:49847872 C>T
- Sequence
atttaattcccatagctgtgtgac[C/T]ctcggccgtttgcttaatgtctct
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.68 | -0.30 | 2.11 | |||
| foreskin keratinocyte | 1.13 | -0.56 | 2.11 |
Items per page:
1 – 2 of 2