rs73228717 chr4:37453237 G>C
- Sequence
aggtatatggattgtaacagctac[G/C]aatgtggaactcagtagattggat
- ASB in cell types
- GM12878 (female B-cells) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.71 | 0.03 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.20 | 0.53 | 2.00 |
Items per page:
1 – 2 of 2