rs73229789 chr4:40308826 C>T
- Sequence
ccactgccttctaagtcaagcaga[C/T]cttggttcaaatcccagctctggc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.27 | 0.69 | 2.01 | |||
| GM12878 (female B-cells) | 0.57 | 0.44 | 1.31 |
Items per page:
1 – 2 of 2