rs73233808 chr7:97065090 C>G
- Sequence
aagtattagagattttaaattttt[C/G]tcctgaactgaaaaagttccattg
- ASB in cell types
- HEK293 (embryonic kidney) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.31 | 0.83 | 1.93 | |||
| CD34+ stem cells-derived erythroblasts | 1.93 | n/a | 2.50 |
Items per page:
1 – 2 of 2