rs7323632 chr13:73090509 G>A
- Sequence
caagtgactgtgagaaggtaataa[G/A]tacatttctggtgattatacctac
- ASB in cell types
- HT29 (colon adenocarcinoma)
- ASB for transcription factors
- NR1H3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR1H3_HUMAN | -3.41 | 1.92 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol change with statins, total cholesterol, triglycerides change with statins