rs732596 chr22:19998625 C>T
- Sequence
ggagctggggggttcctgctttcc[C/T]ctctgttgttttgacaaagaacac
- ASB in cell types
- HEK293 (embryonic kidney) primary endothelial colony-forming cells
- ASB for transcription factors
- GLIS1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLIS1_HUMAN | -0.73 | 1.71 | 2.00 | n/a | n/a | |||
| ANDR_HUMAN | -0.94 | 1.53 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach