rs73262897 chr12:6961967 G>A
- Sequence
aggctcctcagagcacccgggcac[G/A]cccagctcctcccctcatccaggc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.86 | -0.02 | 1.53 | n/a | No Hit | |||
| GATA1_HUMAN | 0.30 | 1.50 | 1.83 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood