rs73293650 chr5:133934429 G>A
- Sequence
tgtatgtcctcaggacaccctggc[G/A]caaggtctggctggcccttccact
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ICN12 (primary pre-B acute lymphomablastic leukemia) | -0.83 | 1.19 | 1.33 |
Items per page:
1 – 1 of 1