rs7339411 chr13:39145157 T>C
- Sequence
acccttgagtcacttcttccctct[T/C]aagcgtctcggtaatcccaagaaa
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.81 | -0.25 | 2.12 | |||
| foreskin keratinocyte | 0.36 | n/a | 2.50 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | 1.50 | -1.76 | 1.33 |
Items per page:
1 – 3 of 3