rs73434240 chr6:42182324 G>A
- Sequence
ttctgctcctttggctggctgcct[G/A]tcgggaaatcctgaaggtcagagt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NR2C1_HUMAN KDM1A_HUMAN MEIS2_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | n/a | 2.03 | 3.00 | n/a | No Hit | |||
| KDM1A_HUMAN | n/a | 2.34 | 3.00 | n/a | n/a | |||
| MEIS2_HUMAN | n/a | 2.42 | 3.00 | n/a | No Hit | |||
| SMCA4_HUMAN | -1.84 | 1.66 | 3.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid