rs734999 chr1:2581777 C>T
- Sequence
aaatacccgtgggaaagaaaagca[C/T]aacagagaacaggagacttatgtg
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.04 | 0.71 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abnormal serum enzyme levels, adverse effects of sedatives or other central nervous system depressants and anesthetics, allergy to serum or vaccine, amblyopia, anterior pituitary disorders, atherosclerosis of renal artery, atrial fibrillation, atrial fibrillation & flutter, atrial flutter, atrophy of edentulous alveolar ridge, av block, bacterial infection nos, benign neoplasm of uterus, cancer of mouth, cardiac and circulatory congenital anomalies, cardiac arrhythmia nos, cardiac congenital anomalies, cardiac dysrhythmias, cardiac pacemaker in situ, cardiac pacemaker/device in situ, central/nonobstroctive sleep apnea, cerebrovascular disease, chronic cystitis, chronic lymphoid leukemia, colostomy and enterostomy complication, coma, stupor, and brain damage, conjunctivitis, infectious, convulsions, corns and callosities, dermatomyositis and polymyositis, develomental delays and disorders, diseases of lips, diseases of nail, diseases of the larynx and vocal cords, diseases of the oral soft tissues, diseases of white blood cells, disorders of fluid, electrolyte, and acid-base balance, disorders of the globe, disorders of the pituitary gland and its hypothalamic control, electrolyte imbalance, empyema and pneumothorax, epilepsy, recurrent seizures, convulsions, exostosis of jaw, fever of unknown origin, fractur of unspecified part of femur, gastroparesis, giant cell arteritis, h. pylori, heart transplant/surgery, heart valve disorders, hemorrhage from gastrointestinal ulcer, hypoventilation, hypovolemia, infection of the eye, intestinal malabsorption, intracerebral hemorrhage, irritable bowel syndrome, ischemic stroke, keratitis, lyme disease, lymphoid leukemia, malignant neoplasm, other, methicillin resistant staphylococcus aureus, muscle weakness, mycoses, nonrheumatic mitral valve disorders, occlusion of cerebral arteries, open wounds of extremities, otalgia, other congenital anomalies, other specified diseases of nail, pagets disease of bone, partial epilepsy, poisoning by other anti-infectives, polymyalgia rheumatica, posttraumatic wound infection, progressive myopia, prolapse of vaginal vault after hysterectomy, respiratory abnormalities, retinal hemorrhage/ischemia, rheumatoid arthritis & related inflammatory polyarthropathies, salicylates causing adverse effects in therapeutic use, sciatica, sinoatrial node dysfunction, speech and language disorder, spirochetal infection, suicidal ideation or attempt, suppurative and unspecified otitis media, swelling, mass, or lump in head and neck, symptoms involving head and neck, urethral stricture (not specified as infectious), urinary tract infection, vaginal enterocele, congenital or acquired, vascular insufficiency of intestine, ventral hernia, voice disturbance
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood