rs735144 chr16:56850012 A>G
- Sequence
agaaagaaaggaaagagccaaagt[A/G]cagccttttctcacttgatcagta
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.85 | -0.11 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, microalbuminuria, restenosis after percutaneous coronary intervention, rheumatoid arthritis, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio
GTEx eQTL Adrenal_Gland, Brain_Spinal_cord_cervical_c-1, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid