rs7356056 chr3:53243460 C>T
- Sequence
ccagcctcccgcccctccaatcag[C/T]gctcccaccaggttaggggtgagt
- ASB in cell types
- coronary artery smooth muscle
- ASB for transcription factors
- JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | 1.76 | -2.00 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Colon_Sigmoid, Muscle_Skeletal, Nerve_Tibial, Pancreas, Whole_Blood