rs735721 chr13:104571874 G>A
- Sequence
ttaactgttgttcagagcaagtcc[G/A]taggagaatgaaattccagttcca
- ASB in cell types
- foreskin keratinocyte MCF7 (Invasive ductal breast carcinoma) uterus SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.59 | 2.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 2.26 | 0.49 | 1.44 | |||
| uterus | -0.91 | 1.23 | 1.33 | |||
| SK-N-SH (neuroblastoma) | -0.07 | 1.03 | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), partial epilepsy, psoriasis, resistance to kuru in aged women despite likely exposure