rs73581403 chr14:21456048 A>G
- Sequence
aagcctacctgtgcaagtcctggt[A/G]cttcctttccaggcagcgtttcaa
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN KDM5B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.93 | -3.57 | 2.50 | n/a | No Hit | |||
| KDM5B_HUMAN | 1.79 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood