rs736008 chr15:24847119 T>C
- Sequence
tcctctacctagaaaacgacattt[T/C]ggcaccaagcataggttactttca
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma) LNCaP (prostate carcinoma) LNCaP C4-2B (prostate carcinoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PANC1 (pancreatic ductal adenocarcinoma) | -2.29 | 2.08 | 1.50 | |||
| LNCaP (prostate carcinoma) | 1.06 | -0.20 | 1.28 | |||
| LNCaP C4-2B (prostate carcinoma) | 0.87 | -0.87 | 1.00 | |||
| neural cell | 1.59 | -1.38 | 3.00 | |||
| epithelial cell of prostate | -1.40 | 1.73 | 1.33 |
Items per page:
1 – 5 of 5