rs736013 chr22:42688607 T>C
- Sequence
gagcagcggtttgttcctggcttg[T/C]ttctagtgggtgtgttcacagacg
- ASB in cell types
- liver
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.12 | -0.68 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence, alcohol dependence (early age of onset), chronic kidney disease, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, height, hip bone mineral density (bmd), schizophrenia, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid, Uterus, Whole_Blood