rs736202 chr1:113276758 C>T
- Sequence
tctcacaaaagcctccagggatgc[C/T]tattggagctccttcacttcaaag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ARI1B_HUMAN IKZF1_HUMAN NCOR1_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | 2.65 | n/a | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | 2.57 | n/a | 1.33 | n/a | No Hit | |||
| NCOR1_HUMAN | 2.72 | -2.71 | 1.33 | n/a | n/a | |||
| KDM1A_HUMAN | 2.57 | -2.79 | 1.33 | n/a | n/a | |||
| HDAC2_HUMAN | 2.54 | -2.78 | 1.33 | n/a | n/a |
Items per page:
1 – 5 of 13
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, cystatin c in serum, hdl cholesterol change with statins, hip bone mineral density (bmd), neuroblastoma (brain cancer), rheumatoid arthritis, spine bone mineral density (bmd)