rs736683 chr2:46983608 T>C
- Sequence
ccactttaactcctcagtgactta[T/C]gaagcccggcacggacctggggca
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.35 | 0.55 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age at death with kuru exposure, alzheimers disease, arthritis including non-rheumatoid, college completion, prop taste detection threshold, serum creatinine, variant creutzfeldt-jakob disease
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Pancreas, Stomach, Thyroid