rs736756 chr1:51878742 A>C
- Sequence
gaacaggcctgaacccctccccca[A/C]cccagtctccctctcgccgacttc
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) HEK293T (embryonic kidney) GM12878 (female B-cells)
- ASB for transcription factors
- SP2_HUMAN ZN341_HUMAN TBX21_HUMAN SCRT2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP2_HUMAN | 1.03 | -1.68 | 2.00 | 2.20 | Discordant | |||
| ZN341_HUMAN | 0.81 | -1.56 | 2.00 | 0.53 | Weak Discordant | |||
| TBX21_HUMAN | 1.65 | -1.22 | 1.33 | n/a | No Hit | |||
| SCRT2_HUMAN | 2.56 | n/a | 2.00 | n/a | n/a | |||
| ZIC2_HUMAN | 2.22 | -1.89 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 9
Motif analysis
Genetic associations
GRASP birth weight, hdl cholesterol change with statins, ldl cholesterol, nicotine dependence (smoking), cigarettes per day, parkinsons disease, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood