rs7369893 chr2:100529463 A>G
- Sequence
gcccgggctgaagtgtagtggggc[A/G]atctcagctcactgcagcctccgc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN426_HUMAN ZN697_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN426_HUMAN | 2.44 | -3.59 | 2.00 | n/a | n/a | |||
| ZN697_HUMAN | 1.65 | -1.17 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg