rs737092 chr20:57415349 T>C
- Sequence
gcctcccgcaggggccgataagtg[T/C]ctggctctgcttatcagccccgtt
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 2.39 | 0.16 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI immature fraction of reticulocytes, mean corpuscular hemoglobin, mean corpuscular volume, red blood cell count, red blood cell traits, red cell distribution width
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, chronic kidney disease, coronary artery disease (cad), cystatin c in serum, infant head circumference, mean corpuscular hemoglobin (mch), mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), obesity with early age of onset (age >2), red blood cell count (rbc), serum creatinine, triglycerides