rs737151 chr20:4760746 G>A
- Sequence
cgtccgggccacgagggggcgcgc[G/A]gacaccacccaccccgccgggcaa
- ASB in cell types
- foreskin keratinocyte erythroid cells T47D (invasive ductal carcinoma) H1 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.65 | n/a | 3.00 | |||
| erythroid cells | n/a | 2.80 | 2.00 | |||
| T47D (invasive ductal carcinoma) | -0.36 | 1.41 | 1.63 | |||
| H1 (embryonic stem cells) | 1.01 | 0.17 | 1.46 | |||
| thoracic aorta | -0.71 | 0.71 | 1.00 |
Items per page:
1 – 5 of 6