rs738435 chr22:29245750 G>A
- Sequence
catgatagtgcactgcaggaactg[G/A]agtgactgtgctgggcctgcccac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) hASC (preadipocytes) foreskin keratinocyte HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.26 | -0.05 | 1.76 | |||
| hASC (preadipocytes) | 1.28 | 0.12 | 1.00 | |||
| foreskin keratinocyte | n/a | 0.24 | 2.50 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 0.93 | -0.34 | 2.00 |
Items per page:
1 – 4 of 4