rs7397425 chr12:132761105 C>T
- Sequence
gatctccacatcacccagacccga[C/T]agtctaccgcaaagcaataaatgg
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -0.44 | 0.81 | 1.11 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis