rs73985902 chr17:48795825 A>C
- Sequence
ctgctggggaaacagctcatgttt[A/C]tctctcctcctcccagcctcccag
- ASB in cell types
- CWR22 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CWR22 (prostate carcinoma) | 1.08 | -0.14 | 1.33 |
Items per page:
1 – 1 of 1