rs74006120 chr17:81859774 A>G
- Sequence
accgtggcggcctgtaccagcact[A/G]gctgtgagtatgagatgcacatcc
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.42 | 0.56 | 1.71 | |||
| HepG2 (hepatoblastoma) | -0.06 | 0.71 | 2.00 | |||
| HEK293T (embryonic kidney) | -0.48 | 1.08 | 2.44 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid