rs7404005 chr16:23853403 A>C
- Sequence
gagaaagcacactcatttcacaac[A/C]acttcagctggggaaggaagtcac
- ASB in cell types
- GM12878 (female B-cells) monocyte-derived macrophages macrophages monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN TF65_HUMAN CEBPB_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.02 | 2.59 | 2.03 | n/a | No Hit | |||
| TF65_HUMAN | n/a | 2.65 | 2.50 | n/a | No Hit | |||
| CEBPB_HUMAN | -1.19 | 2.07 | 2.33 | 0.17 | Weak Concordant | |||
| IKZF1_HUMAN | -0.73 | 1.45 | 1.33 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP alcohol dependence without depressive symptoms, comorbid depressive syndrome and alcohol dependence, type 2 diabetes
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood