rs74046043 chr14:34373382 T>C
- Sequence
ttccctcacagccaccttcttgct[T/C]cctcctcctgcttccccaatgctg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.73 | -0.15 | 1.72 | |||
| GM12878 (female B-cells) | 1.52 | -1.44 | 1.50 |
Items per page:
1 – 2 of 2