rs740539 chr7:156605709 T>C
- Sequence
agagaggtccccctggagatatca[T/C]gcagagcagatgacactggaggcc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.35 | 0.89 | 1.46 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic