rs74055808 chr11:6481482 A>G
- Sequence
tccggggcggcaccgagaagctga[A/G]acggaagtggcgtacggcatgcgc
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma)
- ASB for transcription factors
- GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | 1.75 | -1.27 | 1.50 | -0.22 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
