rs7406820 chr17:62476169 G>A
- Sequence
aatttttgtatttttagtagacac[G/A]gggtttcaccatgttggccaggct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.34 | -3.27 | 2.58 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Lung, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid